View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_low_24 (Length: 306)
Name: NF8185_low_24
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 43506944 - 43507168
Alignment:
| Q |
17 |
agacgggacatgacgtaattgaggattgggtaggttcctgggtttgggtggggatccatggtggtgttggagcatgaaatgaaagtatgaaaccaaatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43506944 |
agacgggacatgacgtaattgaggattgggtaggttcctgggtttgggtggggatccattatggtgttggagcatgaaatgaaagtatgaaaccaaatga |
43507043 |
T |
 |
| Q |
117 |
atgagattatgggaataactcactcagccaaagtttatttatgtaactacgtatttgttttgttgacgaatgtaactatgagataagacaatgggatcca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43507044 |
atgagattatgggaataactcactcagccaaag----tttatgtaac----tatttgttttgttgacgaatgtaactatgagat-----aatgggatcca |
43507130 |
T |
 |
| Q |
217 |
taattggtgagttggtttctttg-ttttttgttgatga |
253 |
Q |
| |
|
| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
43507131 |
tgattggtgagttggtatctttgtttttttgttgatga |
43507168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University