View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8185_low_30 (Length: 264)
Name: NF8185_low_30
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8185_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 16 - 109
Target Start/End: Original strand, 3332498 - 3332591
Alignment:
| Q |
16 |
ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332498 |
ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt |
3332591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 3332658 - 3332730
Alignment:
| Q |
176 |
atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagtgaatgtccatgtgatgttatttgatcc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332658 |
atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagtgaatgtccatgtgatgttatttgatcc |
3332730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University