View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8185_low_30 (Length: 264)

Name: NF8185_low_30
Description: NF8185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8185_low_30
NF8185_low_30
[»] chr5 (2 HSPs)
chr5 (16-109)||(3332498-3332591)
chr5 (176-248)||(3332658-3332730)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 16 - 109
Target Start/End: Original strand, 3332498 - 3332591
Alignment:
16 ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332498 ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt 3332591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 176 - 248
Target Start/End: Original strand, 3332658 - 3332730
Alignment:
176 atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagtgaatgtccatgtgatgttatttgatcc 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332658 atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagtgaatgtccatgtgatgttatttgatcc 3332730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University