View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_18 (Length: 376)
Name: NF8186_high_18
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 14271987 - 14271626
Alignment:
| Q |
1 |
taataataatgtaaa-ttcgagctcccttcaccttccttgatttgattttcaaacagcttgggatgggaagcgcgctcgaaacactatgtggacaagcag |
99 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271987 |
taataataatgtaaaattcgagctcgcttcaccttccttgatttgattttcaaacagcttgggatgggaagcgcgctcgaaacactatgtggacaagcag |
14271888 |
T |
|
| Q |
100 |
taggagctggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgatactattttccatggcatttccactatgccttttatacatcttcgc |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271887 |
taggagcaggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgatactattttccatggcatttccactatgccttttatacatcttcgc |
14271788 |
T |
|
| Q |
200 |
cggatccgttctaaaattcataggacaaacaactgaaatatccgaggctgcaggaacatttgctttatatatgattccacaattatttgcttacgcgctg |
299 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271787 |
cggatccattctaaaattcataggacaaacaactgaaatatccgaggccgcaggaacattcgctttatatatgattccacaattatttgcttacgcgctg |
14271688 |
T |
|
| Q |
300 |
aattttcctgtcgcgaaatttctacaagcgcaaagcatggtgattgtcatcgcggttatatc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271687 |
aattttcctgtcgcgaaatttctacaagcgcaaagcatggtgattgtcatcgcggttatatc |
14271626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 60 - 154
Target Start/End: Complemental strand, 29112249 - 29112155
Alignment:
| Q |
60 |
gggatgggaagcgcgctcgaaacactatgtggacaagcagtaggagctggaaaactcgacatgttaggaatatacatgcaaagatcatgggtgat |
154 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||| | ||||| || ||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29112249 |
gggatgggaagcgcattggagacactatgtggacaagctttcggagcagggaaactagacatgttaggaatatacatgcaaagatcatggttgat |
29112155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University