View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_19 (Length: 372)
Name: NF8186_high_19
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 271; Significance: 1e-151; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 354
Target Start/End: Complemental strand, 9656723 - 9656370
Alignment:
| Q |
1 |
tgcaaccgctttctttgcttacattggttttgatgatgttgccagcactgccgaagaggtatagatcatgataatatattatatttcatgtatattccct |
100 |
Q |
| |
|
|||||| ||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
9656723 |
tgcaacagctttttttgcatacattggttttgatgctgttgccagcactgccgaagaggtatagatcatgataatatattatgtttcatgtatataccct |
9656624 |
T |
|
| Q |
101 |
tataggtcaaattgtgtattcaaatacaaccaatgcgaaaatttgcaaccatttcaaattgccatagccattttgtggttgcatcacaatccttgatatt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9656623 |
tataggtcaaattgt--attcaaatacaaccaatgcgaaaatttgcaaccatttcaaattgccatagccattttgtggttgcatcacaatccttgatatt |
9656526 |
T |
|
| Q |
201 |
acataaagtttcagtgaaatacggatcaatgtttttaaaaccggaccggagacaggttgaaccatagtttaatcggatgactgataacaaataggttctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
9656525 |
acataaagtttcagtgaaatacggatcaatgtttttaaaaccggaccggagacaggttgaaccatagttgaatcggatgactgataacaaataagttctt |
9656426 |
T |
|
| Q |
301 |
aaaaag--nnnnnnnnngggaaaaatgaatgaccattagcggttcaaatcagttcg |
354 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9656425 |
aaaaagtttttttttttgggaaaaatgaacgaccattagcggttcaaatcagttcg |
9656370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 9640434 - 9640360
Alignment:
| Q |
1 |
tgcaaccgctttctttgcttacattggttttgatgatgttgccagcactgccgaagaggtatagatcatgataat |
75 |
Q |
| |
|
|||||| ||||| ||||| ||||| |||||||||| ||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
9640434 |
tgcaacagctttttttgcatacataggttttgatgcagttgccagcgctgctgaagaggtatagatcatgataat |
9640360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 9616022 - 9615955
Alignment:
| Q |
1 |
tgcaaccgctttctttgcttacattggttttgatgatgttgccagcactgccgaagaggtatagatca |
68 |
Q |
| |
|
|||||| || || ||||| ||||| |||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9616022 |
tgcaacagccttttttgcatacataggttttgaagcaattgccagcactgccgaagaggtatagatca |
9615955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University