View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_32 (Length: 305)
Name: NF8186_high_32
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 287
Target Start/End: Original strand, 40110022 - 40110284
Alignment:
| Q |
17 |
ttggtggtagagacaaatatgatatttttatgttatagaggaatatatcatatatgtagtctgaattggttaggtaaaaaagaatggagaatttcaactt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110022 |
ttggtggtagagacaaatatgatatttttatgttatagaggaatatag---atatgtagtctgaattggttaggtaaaaaagaatggagaatttc----- |
40110113 |
T |
 |
| Q |
117 |
tcaagggttattttgtactcttggattccaagagaaaaatttcaaaggtttagattttttaagacagcacaagataatgatcatggttgatcagataatt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110114 |
--aagggttattttgtactcttggattagaagagaaaaatttcaaaggtttagattttttaagacagcacaagataatgatcatggttgatcagataatt |
40110211 |
T |
 |
| Q |
217 |
ataatttaatgttaacca--nnnnnnnnccagttctatccgaacgtgtttatttggtttcattataaggttac |
287 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110212 |
ataatttaatgttaaccattttttttttccagttctatccgaacgtgtttatttggtttcattataaggttac |
40110284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University