View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8186_high_47 (Length: 258)

Name: NF8186_high_47
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8186_high_47
NF8186_high_47
[»] chr4 (1 HSPs)
chr4 (1-254)||(53395773-53396026)


Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 53396026 - 53395773
Alignment:
1 cctcttcacaccccaaataattcttcaacaaaattttcaaagcttgtatcgaacaataactcatgaaaatatgcatatccattctcccactcctcaacaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53396026 cctcttcacaccccaaataattcttcaacaaaattttcaaagcttgtatcgaacaataactcatgaaaatatgcatatccattctcccactcctcaacaa 53395927  T
101 agcaggatcaagcttctcaatatgattcgtggtaaacacaaaaatcctctcactcccacaacaagaccataacccatcagtaaaattcaacaacccagaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53395926 agcaggatcaagcttctcaatatgattcgtggtaaacacaaaaatcctctcactcccacaacaagaccataacccatcagtaaaattcaacaacccagaa 53395827  T
201 agagttattgaattcccattctcttcaccaccacctctcatttcaccaacacca 254  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||    
53395826 agagttattgaattcccattctcttcaccaacacctctcatttcaccaacacca 53395773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University