View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_51 (Length: 251)
Name: NF8186_high_51
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 230
Target Start/End: Complemental strand, 51257248 - 51257034
Alignment:
| Q |
16 |
ataatactgcatgcggtaggaagtttattttaatcagtaacagaatttcagtctttgattatgcagtatacatagacagttgctagttgtttgaagttta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51257248 |
ataatactgcatgcggtaggaagtttattttaatcagtaacagaatttcagtctttgattatgcagtatacatagacagttgctagttgtttgaagttta |
51257149 |
T |
 |
| Q |
116 |
ccctatgactttttgcatctaacctaaaatcatgctatcttatgaattgatttgtattctgtaagaatctactgcttatttaccattgttacagccatcg |
215 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51257148 |
ccctacgattttttgcatctaacctaaaatcatgctatcttatgaattgatttgtattcttgaagaatctactgcttatttaccattgttacagccatcg |
51257049 |
T |
 |
| Q |
216 |
agccgccgtctgcaa |
230 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
51257048 |
agccgccgtctgcaa |
51257034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University