View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_58 (Length: 242)
Name: NF8186_high_58
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_58 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 73 - 242
Target Start/End: Original strand, 41685994 - 41686163
Alignment:
| Q |
73 |
gattttgagtaatgggatttaaatgtgaattggttcaatcaccaatagaacaagttggaccaatggtatcagtgtggacattatcacacactatacttca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41685994 |
gattttgagtaatgggatttaaatgtgaattggttcaatcaccaatagaacaagttggaccaatggtatcagtgtggacattatcacacagtatacttca |
41686093 |
T |
|
| Q |
173 |
ttcaaatcaacttgatatacaaatttatggtacaactacatccccttttgtacgcaaaatactacaactt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686094 |
ttcaaatcaacttgatatacaaatttatggtacaactacatccccttttgtacgcaaaatactacaactt |
41686163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 41685956 - 41686004
Alignment:
| Q |
20 |
ttgagttacgtcatagtcatactacaatcaaaaattatgattttgagta |
68 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41685956 |
ttgagttatgtcatagtcatactacaataaaaaattatgattttgagta |
41686004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 169 - 237
Target Start/End: Original strand, 41659005 - 41659072
Alignment:
| Q |
169 |
ttcattcaaatcaacttgatatacaaatttatggtacaactacatccccttttgtacgcaaaatactac |
237 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||| |||||||||||||||| || ||||||||||| |
|
|
| T |
41659005 |
ttcattcaaatcaa-ttgatatataaattcatggtataactacatccccttttatagacaaaatactac |
41659072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University