View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_60 (Length: 240)
Name: NF8186_high_60
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_60 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 15678349 - 15678128
Alignment:
| Q |
18 |
ttcataacacaactataatattcagtggcagagtaatagacattttagtagtgctagtcgcaaaaataggttcagtctagttagtaaggattcagctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
15678349 |
ttcataacacaactataatattcagtggcagagtaatagacattttagtagtgctagtcgcaaacataggt-cagtctagttagtaaggattcagctcaa |
15678251 |
T |
 |
| Q |
118 |
atctcacaaggaccgaagttcgaatcttgttgtcgacgcaaaaaccacatttgtgggtatctgaaactacatgaccctcttgaggccccgagacccaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15678250 |
atctcacaaggaccgaagttcgaatcttgttgtcgacgcaaaaaccgcatttgtgggtatctgaaactacatgaccctcttgaggccccgagacccaact |
15678151 |
T |
 |
| Q |
218 |
cacataattgtttttctatcaac |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15678150 |
cacataattgtttttctatcaac |
15678128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University