View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_high_67 (Length: 233)
Name: NF8186_high_67
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_high_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 31544229 - 31544442
Alignment:
| Q |
15 |
gaagctcaggttctttatgaaggcgatcgagagtgaaggagagaagttcagagacataaggttgttgagattcggaagctaatggaagtggaattggaag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31544229 |
gaagctcaggttctttatgaaggcgatcgagagtgaaggagagaagttcagagacataaggttgttgagattcagaagctaatggaagtggaattggaag |
31544328 |
T |
 |
| Q |
115 |
cgctgaatcggatcctcctgaaactgcattttcccactccattat--------gagtg-------ggactctgatctggatccggttaaaacaagtaggg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31544329 |
cgctgaatcggatcctcctgaaactgcattttcccactccattatggttctcagagtgggaccgaggactctgatctggatccggttaaaacaagtaggg |
31544428 |
T |
 |
| Q |
200 |
actgatttaaattc |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31544429 |
actgatttaaattc |
31544442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 61 - 116
Target Start/End: Complemental strand, 10731713 - 10731658
Alignment:
| Q |
61 |
ttcagagacataaggttgttgagattcggaagctaatggaagtggaattggaagcg |
116 |
Q |
| |
|
|||| ||||||| |||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
10731713 |
ttcaaagacatagggttgttgcgattgagaggctaatggaagtggaattggaagcg |
10731658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University