View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_23 (Length: 392)
Name: NF8186_low_23
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Original strand, 43289821 - 43290197
Alignment:
| Q |
1 |
aaaacgtagatgatgatgtttgttgatcgggaacttccatggcagcggctttaacggcggcagcttgaacatcacgaggggagtttgaatcgggtcgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289821 |
aaaacgtagatgatgatgtttgttgatcgggaacttccatggcagcggctttaacggcggcagcttgaacatcacgaggggagtttgaatcgggtcgggg |
43289920 |
T |
 |
| Q |
101 |
cattgaagcggcgagttcagggaagttgagtatggcggagttacctttgatggcgagagctgccacgtcatgtgctcgtgctgccatctccggcgtggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43289921 |
cattgaagcggcgagttcagggaagttgagtatggcggagttacctttgatggcgagagctgccacgtcatgtgctcgtgctgccatctccggcgtggca |
43290020 |
T |
 |
| Q |
201 |
aacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttccccaagcccgcattcgaactcctctgtaaaccgggtggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290021 |
aacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttccccaagcccgcattcgaactcctctgtaaaccgggtggt |
43290120 |
T |
 |
| Q |
301 |
tgctctctcttggtcttttgggtctcttttcaaccgggtcaggtaaatgggccgaagatgaagttttaggtagagat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290121 |
tgctctctcttggtcttttgggtctcttttcaaccgggtcaggtaaatgggccgaagatgaagttttaggtagagat |
43290197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 162 - 291
Target Start/End: Complemental strand, 33589307 - 33589178
Alignment:
| Q |
162 |
gccacgtcatgtgctcgtgctgccatctccggcgtggcaaacgttccgagccagatccgattcttctttctcggttcgcggatttcggatacccattttc |
261 |
Q |
| |
|
|||||||| ||||| || || ||||| || | ||| ||| | ||||| |||||||| ||| | ||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
33589307 |
gccacgtcgtgtgcacgcgccgccatttcagccgtagcatatgttccaagccagattcgacttttctttcgtggttcacggatttcggatacccattttc |
33589208 |
T |
 |
| Q |
262 |
cccaagcccgcattcgaactcctctgtaaa |
291 |
Q |
| |
|
|||| | ||||||| ||||||||| |||| |
|
|
| T |
33589207 |
cccatgttcgcattctaactcctctataaa |
33589178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University