View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_29 (Length: 366)
Name: NF8186_low_29
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 150 - 355
Target Start/End: Complemental strand, 28815577 - 28815364
Alignment:
| Q |
150 |
atgataagagagggaggtagtatataagatgcgccgactcccttccggctgcccacaccttagacacgaaaaccattaaacaattcttcttataattccc |
249 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| | |||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28815577 |
atgataagagagggaggtagtatata-gatgcgccgactccctgctggctgcccacaccttaaacacgaaaaccattaaacaattcttcttctaattccc |
28815479 |
T |
|
| Q |
250 |
catgacgtcattttaccaaatttaatatctatag---------nnnnnnnatgtatggtgatagtgatatctgataaccaaatcaaaatgaaattatcat |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28815478 |
catgacgtcattttaccaaatttaatatctatagactttagtttttttttatgtatagtgatagtgatatctgataaccaaatcaaaatgaaattatcat |
28815379 |
T |
|
| Q |
341 |
caaaacatacataga |
355 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28815378 |
caaaacatacataga |
28815364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University