View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_32 (Length: 358)
Name: NF8186_low_32
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 25 - 358
Target Start/End: Original strand, 46184842 - 46185183
Alignment:
| Q |
25 |
cattgattatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgcagctggattcttgtccatgtgtggatttggtgttgttgc |
124 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184842 |
cattgatcatcgtttcaagcccaatatgggtcccagctggtacctttctcttcctccttgctgctggattcttgtccatgtgtggatttggtgttgttgc |
46184941 |
T |
|
| Q |
125 |
tgtagctgcttcctcttggttctaccgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatactgct |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46184942 |
tgtagctgcttcctcttggttctatcgttactttagaggtcttcatcctcccggttcggaccgggttgattatgcaaggaaccgcctttatgatactgct |
46185041 |
T |
|
| Q |
225 |
tctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggatgcagctcctggtgcttgattgaaccaaaccggttc----- |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185042 |
tctcatgttaaagattatgcaagagaatatggtggttatttgcagagtaaggttaaggatgcagctcctggtgcttgattgaaccaaaccggttcggttg |
46185141 |
T |
|
| Q |
320 |
---ggttggttcactagcttatactatcatatatttatattc |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185142 |
gttggttggttcactagcttatactatcatatatttatattc |
46185183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University