View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_39 (Length: 315)
Name: NF8186_low_39
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 39902444 - 39902245
Alignment:
| Q |
12 |
gaacctgtgggaaagttgtagtttgaagctttgagaagagattgatgaagttgttaggactatatatcaacattatgcattcctcaatcaatggcaatgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902444 |
gaacctgtgggaaagttgtagtttgaagctttgagaagagattgatgaagttgttaggactatatatcaacattatgcattcctcaatcaatggcaatgg |
39902345 |
T |
|
| Q |
112 |
atgagattgcaagactcaaacacgattgtagcttggccacgggtagatttggtcaaatggatcatacctccaaacaggttgaaaagcaatattgaggtag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39902344 |
atgagattgcaagactcaaacacgattgtagcttggccacgggtagatttggtcaaatggatcatacctccaaacaggttgaaaagcaatattgatgtag |
39902245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 264 - 298
Target Start/End: Complemental strand, 39902097 - 39902063
Alignment:
| Q |
264 |
atgaggttgaagatgttgattttaaacttgatgca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902097 |
atgaggttgaagatgttgattttaaacttgatgca |
39902063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 242
Target Start/End: Complemental strand, 39902147 - 39902113
Alignment:
| Q |
208 |
gtagaagaggcgtaggctcatgggttcactaaaag |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902147 |
gtagaagaggcgtaggctcatgggttcactaaaag |
39902113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University