View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_44 (Length: 288)
Name: NF8186_low_44
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 272
Target Start/End: Original strand, 38423296 - 38423554
Alignment:
| Q |
13 |
aatatggtcatgtttggtggtttgaacttgatggagaagttttaaacattgaagtagtgggattgattggaatnnnnnnnnnnnntcaagtcgtgcgtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
38423296 |
aatatggtcatgtttggtggtttgaacttgatggagaagttttaaacattgaagtagtgggattgattgggatagagagagag--tcaagtcgtgcgtga |
38423393 |
T |
|
| Q |
113 |
cgtgagttgagtatacgcgtcttatgaaatgggaaatttagtagtatgtgccaactggatggatttcagtatctactcgtgtctggtaagtaagacccct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38423394 |
cgtgagttgagtatacgcgtcttatgaaatgggaaatttagtagtatgtgccaactggatggatttcagtatctactcgtgtctggtaagtaagacccct |
38423493 |
T |
|
| Q |
213 |
tcgttctagttttctataaattc-aaaaaatgctaataagtgttgtgtattgatcaagatg |
272 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38423494 |
tccttctagttttctataaattcaaaaaaatgctaataattgttgtgtattgatcaagatg |
38423554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University