View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_52 (Length: 275)
Name: NF8186_low_52
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 264
Target Start/End: Original strand, 49581636 - 49581874
Alignment:
| Q |
21 |
accatcatgatccgtttttgcagcttcatgcgggtctcccgtgggtcttcttctccttcttctgcttccatggaggtaactaactaacactannnnnnnn |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49581636 |
accatcatgatccgtttttgcagcttcatgcgggtctcccctgggtcttcttctccttcttctgcttccatggaggtaactaactaacactatttttttt |
49581735 |
T |
 |
| Q |
121 |
nnnnnnnnaattcattttattttctctcgtgctttgcttgtcgtacacttttaatgtactctaatatatattttcatacaaaataactcgaattattgta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49581736 |
tta-----aattcattttattttctctcgtgctttgcttgtcgtacacttttaatgtactctaatatatattttcatacaaaataactcgaattattgta |
49581830 |
T |
 |
| Q |
221 |
aatcattagtgtaaaaatctgttgtttgtgttttttagtttcat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49581831 |
aatcattagtgtaaaaatctgttgtttgtgttttttagtttcat |
49581874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University