View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_59 (Length: 258)
Name: NF8186_low_59
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 53396026 - 53395773
Alignment:
| Q |
1 |
cctcttcacaccccaaataattcttcaacaaaattttcaaagcttgtatcgaacaataactcatgaaaatatgcatatccattctcccactcctcaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53396026 |
cctcttcacaccccaaataattcttcaacaaaattttcaaagcttgtatcgaacaataactcatgaaaatatgcatatccattctcccactcctcaacaa |
53395927 |
T |
|
| Q |
101 |
agcaggatcaagcttctcaatatgattcgtggtaaacacaaaaatcctctcactcccacaacaagaccataacccatcagtaaaattcaacaacccagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53395926 |
agcaggatcaagcttctcaatatgattcgtggtaaacacaaaaatcctctcactcccacaacaagaccataacccatcagtaaaattcaacaacccagaa |
53395827 |
T |
|
| Q |
201 |
agagttattgaattcccattctcttcaccaccacctctcatttcaccaacacca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53395826 |
agagttattgaattcccattctcttcaccaacacctctcatttcaccaacacca |
53395773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University