View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_65 (Length: 245)
Name: NF8186_low_65
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_65 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 162 - 219
Target Start/End: Original strand, 18512833 - 18512890
Alignment:
| Q |
162 |
tattccttcccaaaagcagtgttgttaagtggcagtcatggcaccgccatggaagaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
18512833 |
tattccttcccaaaagcagtgttgttaagtggcggtcatggcaccgccatggcagaat |
18512890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 84
Target Start/End: Original strand, 18512673 - 18512747
Alignment:
| Q |
7 |
ttggtgttgccttttcatttggcaatgacttcactatttcataaacgagactcttctgatctgcttcagatagagttt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||| |||| | ||| |||||| |||||||||| ||||||| |
|
|
| T |
18512673 |
ttggtgttgccttttcatttggcaatgactacac---ttcttaaatcatactattctgagctgcttcagaaagagttt |
18512747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 161 - 224
Target Start/End: Complemental strand, 14516819 - 14516756
Alignment:
| Q |
161 |
atattccttcccaaaagcagtgttgttaagtggcagtcatggcaccgccatggaagaatggcat |
224 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||| ||||||||| |||||||||| |
|
|
| T |
14516819 |
atattcctatccaaaagcagtgttgttaagtggcggtcatggtgccgccatggcagaatggcat |
14516756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 224
Target Start/End: Original strand, 32124547 - 32124593
Alignment:
| Q |
178 |
cagtgttgttaagtggcagtcatggcaccgccatggaagaatggcat |
224 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
32124547 |
cagtgttgttaaatggctatcatggcaccgccatggaagaatggcat |
32124593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University