View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_72 (Length: 241)
Name: NF8186_low_72
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_72 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 9660715 - 9660796
Alignment:
| Q |
160 |
ttattttgactaacttataaatacattttcataccctataattttttagatatatccaacatccaactatttgacccacgtc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
9660715 |
ttattttgactaacttataaatacattttcataccctataattgtttaggtgtatccaacatccaactatttgacccacgtc |
9660796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 28 - 83
Target Start/End: Original strand, 9659997 - 9660052
Alignment:
| Q |
28 |
tttctaactaatgctatagacttccttcttgttatgtttatgtgtaagataatctc |
83 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9659997 |
tttctaactaatgctataggcttccttcttgttatgtttatgtgtaagataatctc |
9660052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University