View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_75 (Length: 240)
Name: NF8186_low_75
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 33152529 - 33152349
Alignment:
| Q |
1 |
ttttttaaatccgataatttatattaaatatcttctaaatctatacggatgcaaattaacaaggataaacatctaaaccatattcatgtgtcgactgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33152529 |
ttttttaaatccgataatttatattaaatatcttctaaatctatacggatgcaaattaacaacgataaacatctaaaccatattcatgtgtcgactgtca |
33152430 |
T |
|
| Q |
101 |
tccctagttagcattccaggttggaattggatatctttccaacacactatatatcctgttattttctctcttaaattttcc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33152429 |
tccctagttagcattccaggttggaattggatatctttccaacacactatatatcctgttactttctctcttaaattttcc |
33152349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University