View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_76 (Length: 240)
Name: NF8186_low_76
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 28442723 - 28442501
Alignment:
| Q |
1 |
tccattagcaaatctctctgggttgaatttgtaggcatcttctccccaaatatcaggatttgtatgcaaacttagtatcaatatccaaaggccagtgccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28442723 |
tccattagcaaatctctctgggttgaatttgtaggcatcttctccccaaatatcaggatttgtatgcaaacttagtatcaatatccaaaggccagtgccc |
28442624 |
T |
 |
| Q |
101 |
tttgggacatcgatattcccgaatttcatgtcctccaaagcgtgtcttggcaataaaggtacaggtggataaaggcgcaacgattcatgaataaccattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28442623 |
tttgggacatcgatattcccgaatttcatgtcctcctaagtgtgtcttggcaataaaggtacaggtggataaaggcgcaacgattcatgaataaacatta |
28442524 |
T |
 |
| Q |
201 |
tcacctgcattgaatgccacaac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28442523 |
tcacctgcattgaatgccacaac |
28442501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 66 - 222
Target Start/End: Complemental strand, 28440451 - 28440295
Alignment:
| Q |
66 |
gcaaacttagtatcaatatccaaaggccagtgccctttgggacatcgatattcccgaatttcatgtcctccaaagcgtgtcttggcaataaaggtacagg |
165 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||| |||||||| |||||||| ||||||||||||| ||| | | |||| |||||||||||||| |
|
|
| T |
28440451 |
gcaaacttattatcaatatccaaagttcagtgcccttagggacatcaatattcccaaatttcatgtccttgaaaacattccttgacaataaaggtacagc |
28440352 |
T |
 |
| Q |
166 |
tggataaaggcgcaacgattcatgaataaccattgtcacctgcattgaatgccacaa |
222 |
Q |
| |
|
|| |||||||||| | |||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
28440351 |
tgaataaaggcgcgaggattcatgaataaccattgttagctgcattttatgccacaa |
28440295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University