View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8186_low_95 (Length: 203)
Name: NF8186_low_95
Description: NF8186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8186_low_95 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 108 - 203
Target Start/End: Complemental strand, 3046486 - 3046391
Alignment:
| Q |
108 |
tcagcttttgttccatgaaggaaggaaaattctcgatggtgtgtttttgttaaatgaatttgtggattacgcgaaaagaagtagaaaagggtgttt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3046486 |
tcagcttttgttccatgaaggaaggaaaatactcgatggtgtgtttttgttaaatgaatttatggattacgcgaaaagaagtagaaaagggtgttt |
3046391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 3046572 - 3046517
Alignment:
| Q |
16 |
aaatatttgaccctttattaaaagattttgcattttattgaaccctactccccaac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3046572 |
aaatatttgaccctttattaaaagattttgcattttattgaaccctactccccaac |
3046517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University