View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8187_low_9 (Length: 235)
Name: NF8187_low_9
Description: NF8187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8187_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 46312631 - 46312854
Alignment:
| Q |
1 |
ttattttacggttcagcggttccttaacggcggttcatggttgcctagaacaggtgttaagttcacagcagggctaagcaattgagtttccaagccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46312631 |
ttattttacggttcagcggttccttaacggtggttcatggttgcctagaacaggtgttaagttcacagcagggctaagcaattgagtttccaagccaatt |
46312730 |
T |
 |
| Q |
101 |
gatgaatgctatttgttatttattgatcctagttattaatgtaaactagaagcgaataagtttactacttcagtttttagatgaataatttgtaccattt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46312731 |
gatgaatgctatttgttatttactgatcctagttattaatgtaaactagaagcgaataagtttactacttcagtttttagatgaataatttgtaccattt |
46312830 |
T |
 |
| Q |
201 |
tctttgattaatgatggaatattt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46312831 |
tctttgattaatgatggaatattt |
46312854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University