View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8188_low_2 (Length: 401)
Name: NF8188_low_2
Description: NF8188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8188_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 20 - 391
Target Start/End: Complemental strand, 49914541 - 49914170
Alignment:
| Q |
20 |
gtcatcctcaacccgggccggtggcccgaatccaggaggaacatcatcatcatcaccactcggaggttcactcacggtggtcttaaaccccatagagggc |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914541 |
gtcatcctcaacccgggctggtggcccgaatccaggaggaacatcatcatcatcaccactcggaggttcactcacggtggtcttaaaccccatagagggc |
49914442 |
T |
 |
| Q |
120 |
actgcattatgggtagaattggcattcacattagtatcttgttgtcttctactcaaaatttgccttttagagctatgtttgtgatgtgattgcgcggtgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914441 |
actgcattatgggtagaattggcattcacattagtatcttgttgtcttctactcaaaatttgccttttagagctatgtttgtgatgtgattgcgcggtgg |
49914342 |
T |
 |
| Q |
220 |
gagatatagatgtagttatattagtttttctccatacaataataccaattagaccattatcaatagaattaactgcttcaatttgttcctttggaagtat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914341 |
gagatatagatgtagttatattagtttttctccatacaataataccaattagaccattatcaatagaattaactgcttcaatttgttcctttggaagtat |
49914242 |
T |
 |
| Q |
320 |
cttgctgagcatttcaactgttttcttatgaggtgggcaaaagtaaagttcaactccatgcacaggttctgc |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49914241 |
cttgctgagcatttcaactgttttcttatgaggtgggcaaaagtaaagttcaactccatgcacaggttctgc |
49914170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University