View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8188_low_5 (Length: 222)
Name: NF8188_low_5
Description: NF8188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8188_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 4618778 - 4618570
Alignment:
| Q |
1 |
ttgttcctagaactcggttctagattgactgtggcagggctatttctttttcgttttatgctttaattattgtgtctaatgtgaacacttggattttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4618778 |
ttgttcctagaactcggttctagattgactgtggcagggctatttctttttcgttttatgctttaattattgtgtctaatgtgaacacttggattttgtt |
4618679 |
T |
 |
| Q |
101 |
gacatcaagtttctgaacatgctgagcttgattttgttttgaatatcaattctttatttgtgtatttacttcttggtgtaatgttttatgttcttgccgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4618678 |
gacatcaagtttctgaacatgctgagcctgattttgttttgaatatcaactctttatttgtgtatttacttcttggtgtaatgttttatgttcttgccgg |
4618579 |
T |
 |
| Q |
201 |
gtgtctctg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
4618578 |
gtgtctctg |
4618570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 7892196 - 7892295
Alignment:
| Q |
1 |
ttgttcctagaactcggttctagattgactgtggcagggctatttctttttcgtttt-atgctttaattattgtgtctaatgtgaacacttggattttgt |
99 |
Q |
| |
|
|||||||||||||| | |||||||| | | |||||||| | |||||||||| ||||| ||||| | ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
7892196 |
ttgttcctagaactggcttctagatcggcggtggcaggtccatttcttttttgtttttatgctatgattattgtgtctagtgtgaatacttggattttgt |
7892295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 43044081 - 43043990
Alignment:
| Q |
9 |
agaactcggttctagattgactgtggcagggctatttctttttcgtttt-atgctttaattattgtgtctaatgtgaacacttggattttgt |
99 |
Q |
| |
|
|||||| |||||||||| ||| ||||||| |||| ||| ||| ||||| ||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
43044081 |
agaactgggttctagatcgacggtggcagtactatatctgttttgtttttatgctttaattgttgtgtctagtctgaacacttggattttgt |
43043990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 50 - 168
Target Start/End: Original strand, 45984933 - 45985043
Alignment:
| Q |
50 |
ttcgttttatgctttaattattgtgtctaatgtgaacacttggattttgttgacatcaagtttctgaacatgctgagcttgattttgttttgaatatcaa |
149 |
Q |
| |
|
||||||||||| | |||||| ||||||| ||||||||||||||||||| | || | |||||||| || |||||| |||||||||||||||||| |
|
|
| T |
45984933 |
ttcgttttatgttctaatta--gtgtctagtgtgaacacttggattttgctagcagcgagtttctggacctgctga------ttttgttttgaatatcaa |
45985024 |
T |
 |
| Q |
150 |
ttctttatttgtgtattta |
168 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
45985025 |
ctctttatttgtgtgttta |
45985043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 43067910 - 43068000
Alignment:
| Q |
9 |
agaactcggttctagattgactgtggcagggctatttct-ttttcgttttatgctttaattattgtgtctaatgtgaacacttggattttgt |
99 |
Q |
| |
|
|||||| |||||||||| ||| ||||||| ||| | ||| |||| ||||||||||||||| ||||||||| | |||| ||||||||||||| |
|
|
| T |
43067910 |
agaactgggttctagatcgacggtggcagcgctctatctgttttatttttatgctttaattgttgtgtctagtctgaa-acttggattttgt |
43068000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 9 - 99
Target Start/End: Complemental strand, 43082925 - 43082835
Alignment:
| Q |
9 |
agaactcggttctagattgactgtggcagggctatttctttttcgtttt-atgctttaattattgtgtctaatgtgaacacttggattttgt |
99 |
Q |
| |
|
|||||| |||||||||| ||| ||||||| ||| | ||| ||| ||||| ||||||||||| ||||||||| | |||| ||||||||||||| |
|
|
| T |
43082925 |
agaactgggttctagatcgacggtggcagcgctctatctgttttgtttttatgctttaattgttgtgtctagtctgaa-acttggattttgt |
43082835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 3299825 - 3299761
Alignment:
| Q |
1 |
ttgttcctagaactcggttctagattgactgtggcagggctatttctttttcgt-tttatgcttt |
64 |
Q |
| |
|
||||||| | |||| |||||| ||| ||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
3299825 |
ttgttcccaaaactgggttcttgatcgacggtggcagggctatttcttttccgtgtttatgcttt |
3299761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University