View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8189_low_4 (Length: 266)
Name: NF8189_low_4
Description: NF8189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8189_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 54701927 - 54701678
Alignment:
| Q |
1 |
tttttcattgctttcaagtttccaagtgcctttgcaatagctttcttcatcttcttcctatatgacaagtattttccttccaccctcaactgtgattcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701927 |
tttttcattgctttcaagtttccaagtgcctctgcaatagctttcttcatcttcttcctatatgacaagtattttccttccaccctcaactgtgattcca |
54701828 |
T |
 |
| Q |
101 |
ctttccacagctctcctcctgagaataactgaccgtagttcatgcatgatatcctttgattgcaccatacaatctttaactagatccatcaaatagttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701827 |
ctttccacagctctcctcctgagaataactgaccttagttcatgcatgatatcctttgattgcaccatacaatctttaactagatccatcaaatagttca |
54701728 |
T |
 |
| Q |
201 |
tcaacttgtttctcgctgccttatcgtgccaatgcttgttgggaaattgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701727 |
tcaacttgtttctcgctgccttatcgtgccaatgcttgttgggaaattgt |
54701678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University