View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8190_low_14 (Length: 211)

Name: NF8190_low_14
Description: NF8190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8190_low_14
NF8190_low_14
[»] chr8 (1 HSPs)
chr8 (17-159)||(40276988-40277129)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 40276988 - 40277129
Alignment:
17 aaaatcccaccaaattcggcatcatctgcttcattgtgtaacagatttgttcnnnnnnnnnnnnnnnnnnnnnnaataagtaacatatttctgtttttgg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||                      ||||||||||||||||||||||||||    
40276988 aaaatcccaccaaattcggcatcatctgcttcattgtgtaacagatttgttcttttttgttttgttttgtttg-aataagtaacatatttctgtttttgg 40277086  T
117 gcaaggaataattgtaacgtatcttagattactagcagaaata 159  Q
    |||||||||||||||||||||||||||||||||||||||||||    
40277087 gcaaggaataattgtaacgtatcttagattactagcagaaata 40277129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University