View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8190_low_15 (Length: 210)
Name: NF8190_low_15
Description: NF8190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8190_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 34 - 186
Target Start/End: Original strand, 54012201 - 54012353
Alignment:
| Q |
34 |
taaaagaagaaattcaataacatgacaaaccttgttcaatgcagctaggctaatgactttaacacccattttatcagccctgaggattgcttgctcaatt |
133 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012201 |
taaaagaagaaattcaataatatgacaaaccttgttcaatgcagctaggctaatgactttaacacccattttatcagccctgaggattgcttgctcaatt |
54012300 |
T |
 |
| Q |
134 |
tgcttgttaattccatcagtagcaaatggcaagaaatactgttaacaatattg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012301 |
tgcttgttaattccatcagtagcaaatggcaagaaatactgttaacaatattg |
54012353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University