View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8190_low_2 (Length: 455)
Name: NF8190_low_2
Description: NF8190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8190_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 119 - 332
Target Start/End: Complemental strand, 41547094 - 41546881
Alignment:
| Q |
119 |
ccaagagtttataacattgaccgtgagttaccggttctatcggttgttgtagcgaacattaccggatatagcaggttactggtgaagacagcgttagacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547094 |
ccaagagtttataacattgaccgtgagttaccggttcgatcggttgttgtagcgaacattaccggatatagcaggttactggtgaagacagcgttagacc |
41546995 |
T |
|
| Q |
219 |
ggttccacgcaatcacttggttgatgtgatggtgacacgtgggtgagttttggatcttgtggctgattctggtccgcttgatcgtgaatgacgcttagtc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41546994 |
ggttccacgcaatcacttggttgatgtgatggtgacacgtggatgagttttggatcttgtggctgattctggtccgcttgatcgtgaatgacgcttagtc |
41546895 |
T |
|
| Q |
319 |
actcactcactcaa |
332 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41546894 |
actcactcactcaa |
41546881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 41547196 - 41547138
Alignment:
| Q |
17 |
atggttgttgttgaatctgaaatgaatctaagaaacgtgttagttctgttatgagagac |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41547196 |
atggttgttgttgaatctgaaatgaatctaagaaacgtgttagttctgttatgagagac |
41547138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 398 - 444
Target Start/End: Complemental strand, 41546815 - 41546768
Alignment:
| Q |
398 |
agtttcaaattt-gttttgtacttgtagaaatttttgtcacacttcat |
444 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41546815 |
agtttcaaattttgttttgtacttgtagaaatttttgtcacacttcat |
41546768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University