View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_high_17 (Length: 251)
Name: NF8191_high_17
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3474152 - 3474051
Alignment:
| Q |
1 |
gaaccaatttattcgtttattattccctctaaaagttatatccacagaacatgcatgactcactcattgctcaagctatattgtggtgcaatgttgagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3474152 |
gaaccaatttattcgtttattattccctctaaaagttatatccacagaacatgcatgactcactcattgctcaagctatattgtggtgcaatgttgagga |
3474053 |
T |
 |
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
3474052 |
ta |
3474051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 3473986 - 3473922
Alignment:
| Q |
167 |
gacagatcttaggtggcaactgaagtacgtggaaaatagagatttgagcttcagatggagcctct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
3473986 |
gacagatcttaggtggcaactgaagtacgtgaaaaatagagatttgagcttcaggtggagcctct |
3473922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University