View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_high_22 (Length: 208)
Name: NF8191_high_22
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 14 - 188
Target Start/End: Original strand, 13576478 - 13576656
Alignment:
| Q |
14 |
gagaagaatcagaggcgaaagggcttagatttagggtctagatgagattagttggatctataattagggttatgtccttaggtttgatgtatcttttgtg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13576478 |
gagaagaatcagaggcgaaagggcttagatttagggtttagatgagattagcaggatctataattagggttgtgttcttaggtttgatgtatcttttgtg |
13576577 |
T |
|
| Q |
114 |
actttagtctgattttctatg----tgttaagaaattgaatctaatggctgttttatgatgatgaatcttgaatgttat |
188 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13576578 |
actttagtctgattttcaatgtgtttgttaagaaatttaatctaatggcttttttatgatgatgaatcttgaatgttat |
13576656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University