View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_high_23 (Length: 204)
Name: NF8191_high_23
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 98 - 189
Target Start/End: Original strand, 33634151 - 33634242
Alignment:
| Q |
98 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttctt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33634151 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttctt |
33634242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 101 - 184
Target Start/End: Complemental strand, 29191683 - 29191591
Alignment:
| Q |
101 |
tgcgaacgaaatttcccactcgtcactcagtgagt---------ttgatcttactgcaactgttcccgccatttgtttgaattatctcttttc |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
29191683 |
tgcgaaggaaatttcccactcgtcactcagtgagtttgttgttgttgatctcactgcaactgttcccgccatttttttgaattctctcctttc |
29191591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University