View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_low_13 (Length: 288)
Name: NF8191_low_13
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_low_13 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 170 - 288
Target Start/End: Original strand, 47037019 - 47037137
Alignment:
| Q |
170 |
tcttgatggtccctactcataaaaaacaaatggaatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgctcattct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037019 |
tcttgatggtccctactcataaaaaacaaatggtatggtaagctccaaaacactctttgagattgagcactactattctttcacctgtctcgctcattct |
47037118 |
T |
 |
| Q |
270 |
acatatcaacaactgcctc |
288 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47037119 |
acatatcaacaactgcctc |
47037137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 47036850 - 47036954
Alignment:
| Q |
3 |
tggagtagcagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
102 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036850 |
tggaggagaagagagcattcacatgacaaccgataaacataactgcatttatcataaatataataccgacatgactctgtaattgtgctcctgattcttt |
47036949 |
T |
 |
| Q |
103 |
ttcat |
107 |
Q |
| |
|
||||| |
|
|
| T |
47036950 |
ttcat |
47036954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University