View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_low_15 (Length: 278)
Name: NF8191_low_15
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 13 - 128
Target Start/End: Original strand, 30730576 - 30730691
Alignment:
| Q |
13 |
gataatactaatgacggttcaaattaatctacatcttatttctcaaacaattatgcttgaggcctaaaccactttattgctccttgaaagcaatgatgaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30730576 |
gataatactaatgacggttcaaattaatctacaacttatttctcaaactattatgcttgaggcctaaaccactttattgctccttgaaagcaatgatgaa |
30730675 |
T |
 |
| Q |
113 |
acttacttggaagcaa |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30730676 |
acttacttggaagcaa |
30730691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 182 - 260
Target Start/End: Original strand, 30730730 - 30730807
Alignment:
| Q |
182 |
atgaacagagggaaaaaataaagcaagtttagaagaattacattacatgataataatgaatacaaacaaaccaaataaa |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30730730 |
atgaacagagggaaaa-ataaagcaagtttagaagaattacattacatgataataatgaatacaaacaaaccaaataaa |
30730807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University