View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_low_18 (Length: 259)
Name: NF8191_low_18
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 7622195 - 7622079
Alignment:
| Q |
138 |
gacttttattatttaaacactcacacataaataatattgtgatcatgcctgatttatcagagaaaaggaatcttgtatgagactgtttttctatgacagt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622195 |
gacttttattatttaaacactcacacataaataatattgtgatcatgcctgatttatcagagaaaaggaatcttgtatgagactgtttttctatgacagt |
7622096 |
T |
|
| Q |
238 |
agaataatctagccagga |
255 |
Q |
| |
|
|||| || |||||||||| |
|
|
| T |
7622095 |
agaacaa-ctagccagga |
7622079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 7622310 - 7622264
Alignment:
| Q |
20 |
gttgtctcacaccaccaccaacaatccttttcttaaaattttgcaga |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7622310 |
gttgtctcacaccaccaccaacaatccttttcttaaaattttgcaga |
7622264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University