View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8191_low_21 (Length: 251)

Name: NF8191_low_21
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8191_low_21
NF8191_low_21
[»] chr7 (2 HSPs)
chr7 (1-102)||(3474051-3474152)
chr7 (167-231)||(3473922-3473986)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3474152 - 3474051
Alignment:
1 gaaccaatttattcgtttattattccctctaaaagttatatccacagaacatgcatgactcactcattgctcaagctatattgtggtgcaatgttgagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3474152 gaaccaatttattcgtttattattccctctaaaagttatatccacagaacatgcatgactcactcattgctcaagctatattgtggtgcaatgttgagga 3474053  T
101 ta 102  Q
    ||    
3474052 ta 3474051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 167 - 231
Target Start/End: Complemental strand, 3473986 - 3473922
Alignment:
167 gacagatcttaggtggcaactgaagtacgtggaaaatagagatttgagcttcagatggagcctct 231  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||    
3473986 gacagatcttaggtggcaactgaagtacgtgaaaaatagagatttgagcttcaggtggagcctct 3473922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University