View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_low_26 (Length: 221)
Name: NF8191_low_26
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 38 - 201
Target Start/End: Complemental strand, 4599310 - 4599147
Alignment:
| Q |
38 |
ttggagcatgggtgagtaggactctcttgagattattgttatatattatttgatggaaacttctatggtgtactcgcaaattaagttgtaccagtactct |
137 |
Q |
| |
|
||||| || ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4599310 |
ttggaccaagggtgagtaagactctcttgcaattattgttatatattatttgatggaaacttctatgatgtactcgcaaattaagttgtaccagtactct |
4599211 |
T |
 |
| Q |
138 |
taactaaacaatatgtgcaggctgcgacttggttatatgtttgtccaaaggggattcaggacct |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599210 |
taactaaacaatatgtgcaggctgcaacttggttatatgtttgtccaaaggggattcaggacct |
4599147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 4623724 - 4623649
Alignment:
| Q |
16 |
aagaataaagatgggacatacattggagcatgggtgagtaggactctcttgagattattgttatatattatttgat |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
4623724 |
aagaataaagatgggacatacattggagcatgggtgagtaagactctcttgagattattgttacatcttatttgat |
4623649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 138 - 201
Target Start/End: Complemental strand, 4623637 - 4623574
Alignment:
| Q |
138 |
taactaaacaatatgtgcaggctgcgacttggttatatgtttgtccaaaggggattcaggacct |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4623637 |
taactaaacaatatgtgcaggctgcaacttggttatatgtttgtccaaagggtattcaggacct |
4623574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University