View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8191_low_6 (Length: 376)
Name: NF8191_low_6
Description: NF8191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8191_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 4388228 - 4387972
Alignment:
| Q |
20 |
cggtagaacttcttaattactaggagcccccttcccctaggaaccggaagcttaacacacnnnnnnnnnnttaaaattcttccgcccaccaaacacttct |
119 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4388228 |
cggtagaacttcctaattactaggagcccccttcccctaggaaccggaagcttaacaca---aaaaaaaattaaaattcttccgcccaccaaacacttct |
4388132 |
T |
|
| Q |
120 |
ttgtgttttatgggtgcctcttttgttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaat |
219 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388131 |
ttgtgtgttatgggtgcctcttt-gttgatcctatcatctcatcaatgattgtgttgatttgtgtcgctctgccttcctttgtgactccaatcaaacaat |
4388033 |
T |
|
| Q |
220 |
ttgttgaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacagaagca |
280 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388032 |
ttgtttaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacagaagca |
4387972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University