View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8192_low_2 (Length: 219)
Name: NF8192_low_2
Description: NF8192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8192_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 37019760 - 37019932
Alignment:
| Q |
11 |
gaagcagagagaaacgatggagtttcaagggttctagggcacagtttcgaagtgggtgatttggtttggggaaaagtgaaatctcatccatggtggccag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37019760 |
gaagcagagagaaacgatggagtttcaagggttctagggcacagtttcgaagtgggtgatttggtttggggaaaagtgaaatctcatccatggtggccag |
37019859 |
T |
 |
| Q |
111 |
ggtacatatgcaacgaagcttttgcatcttcttcagcacgacttggcaagaaagaagggtgtgtgttggttgc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37019860 |
ggtacatatgcaacgaagcttttgcatcttcttcagcacgacttggcaagaaagaagggtgtgtgttggttgc |
37019932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 54 - 138
Target Start/End: Complemental strand, 46596299 - 46596215
Alignment:
| Q |
54 |
gtttcgaagtgggtgatttggtttggggaaaagtgaaatctcatccatggtggccagggtacatatgcaacgaagcttttgcatc |
138 |
Q |
| |
|
|||| ||||| || ||||| |||||||||||||| |||||||||||||||||||| ||| | |||| ||| |||| |||||||| |
|
|
| T |
46596299 |
gttttgaagttggcgatttagtttggggaaaagttaaatctcatccatggtggccggggcatatatacaatcaagcatttgcatc |
46596215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University