View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8193_low_1 (Length: 404)
Name: NF8193_low_1
Description: NF8193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8193_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 4 - 388
Target Start/End: Complemental strand, 7133412 - 7133028
Alignment:
| Q |
4 |
cagaatcgggatgttttgctacagaaccttgcctctgtagtcgaaggcagggataaggttctggtcgagatgtcccgccttgctgttttggaaggtaggt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7133412 |
cagaatcgggatgttttgctacagaaccttgcctctgtagtcgaaggcagggataaggttctggtcgagatgtcccgccttgctgttttggaaggtaggt |
7133313 |
T |
|
| Q |
104 |
ttcgacctggcagtggtttcaatttggaagaggcccgtgctagtctggaggccagttttgccaatgaagctgaaatagttttcactactgtttctagcag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7133312 |
ttcgacctggcagtggtttcaatttggaagaggcccgtgctagtctggaggccagttttgccaatgaagctgaaatagttttcactactgtttctagcag |
7133213 |
T |
|
| Q |
204 |
tggccgcaagttgttttctcgtctttcccatggatttgatatggtagtaattgacgaggcagcccaagccagtgaagtgggagttcttcctcccctttct |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7133212 |
tggccgcaagttgttttctcgtctttcccatggatttgatatggtagtaattgacgaggcagcccaagccagtgaggtgggagttcttcctcccctttct |
7133113 |
T |
|
| Q |
304 |
cttggggcagcacgatgtgttcttgttggagatcctcaacagcttcctgctacagttatcagcaaggctgcaggaacattgatgt |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7133112 |
cttggggcagcacgatgtgttcttgttggagatcctcaacagcttcctgctacagttatcagcaaggctgcaggaaccttgatgt |
7133028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University