View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8194_low_5 (Length: 266)
Name: NF8194_low_5
Description: NF8194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8194_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 199 - 251
Target Start/End: Complemental strand, 39955101 - 39955049
Alignment:
| Q |
199 |
cctcaacttcattacttcattgcaaatggtatctttctgcttcagttcatctc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39955101 |
cctcaacttcattacttcattgcaaatggtatctttctgcttcagttcatctc |
39955049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 90 - 138
Target Start/End: Complemental strand, 39955210 - 39955162
Alignment:
| Q |
90 |
aactttctctctcttccatcaacatcattacttcatcacaaatggtata |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39955210 |
aactttctctctcttccatcaacatcattacttcatcacaaatggtata |
39955162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 199 - 237
Target Start/End: Complemental strand, 39954750 - 39954712
Alignment:
| Q |
199 |
cctcaacttcattacttcattgcaaatggtatctttctg |
237 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39954750 |
cctcaacttcattacgtcattacaaatggtatctttctg |
39954712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University