View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8195_low_9 (Length: 306)
Name: NF8195_low_9
Description: NF8195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8195_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 58 - 158
Target Start/End: Complemental strand, 960128 - 960028
Alignment:
| Q |
58 |
tgtgtgtgtgatttccctctctgaaatatgaacatgaatatcaatatggataccccagagaggaaccagatcaacaccaccctctctaagttcgaggtca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
960128 |
tgtgtgtgtgatttccctctctgaaatatgaacatgaatatcaatatggataccccagagaggaaccagatcaacaccaccctctctaagttcgaggtca |
960029 |
T |
 |
| Q |
158 |
g |
158 |
Q |
| |
|
| |
|
|
| T |
960028 |
g |
960028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University