View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8196_high_8 (Length: 297)
Name: NF8196_high_8
Description: NF8196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8196_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 286
Target Start/End: Original strand, 41858422 - 41858690
Alignment:
| Q |
18 |
gtaacttctctttattttgattaaacatatataaaaaattaaacaaacttgcatatagttaccgattaagattgattaaaagataaaatcctttccccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41858422 |
gtaacttctctttattttgattaaacatatataaaaaattaaacaaacttgcatatagttaccgattaagattgattaaaagataaaatgctttccccat |
41858521 |
T |
 |
| Q |
118 |
tgtttaagtttcagtgtttcagttttatgttattgtannnnnnnccctattgtttgagtatccttcgccnnnnnnnnnnnnnnnnnnattgtatcatttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41858522 |
tgtttaagtttcagtgtttcagttttatgttattgtatttttttccctattgtttgagtatccttcgcctttttttgttttttttttattgtatcatttg |
41858621 |
T |
 |
| Q |
218 |
tatacatgcacaattactgcacagtgatatgatgtcatgctttaccaagttttaacccttttcatctca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41858622 |
tatacatgcacaattactgcacagtgatatgatgtcatgctttaccaagttttaccccttttcatctca |
41858690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University