View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8198_high_11 (Length: 295)

Name: NF8198_high_11
Description: NF8198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8198_high_11
NF8198_high_11
[»] chr7 (1 HSPs)
chr7 (229-258)||(27870558-27870587)


Alignment Details
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 258
Target Start/End: Complemental strand, 27870587 - 27870558
Alignment:
229 ttgatgagttttattttgtgtgaatggact 258  Q
    ||||||||||||||||||||||||||||||    
27870587 ttgatgagttttattttgtgtgaatggact 27870558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University