View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8198_high_16 (Length: 243)
Name: NF8198_high_16
Description: NF8198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8198_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 32257559 - 32257771
Alignment:
| Q |
20 |
ttaatatcagtaaaaatatcagtgtatattaataactaaacaaccatttcctctccagaagaactaaccaatcatttatttctcaggggttacatgtgtt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32257559 |
ttaatatcagtaaaaatatcagtgtatattaataactaagcaaccatttcctctccagaagaactaaccaatcatttatttctcaggggttacatgtgtt |
32257658 |
T |
 |
| Q |
120 |
ctcatttctcacgtatgcggtctctcttgattgttgttttttactttatttgatgtgaaaaagctttttatgttgagaagtactaagggtttgttgtggc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32257659 |
ctcatttctcacgtatgcggtctctcttgattgttgttttttactttatttgatgtgaaaaatctttttatgttgagaag---taagggtttgttgtggc |
32257755 |
T |
 |
| Q |
220 |
aagcgtgtgtgcggtg |
235 |
Q |
| |
|
||| ||| ||| |||| |
|
|
| T |
32257756 |
aagtgtgggtgtggtg |
32257771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University