View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8198_high_9 (Length: 345)
Name: NF8198_high_9
Description: NF8198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8198_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 12 - 312
Target Start/End: Complemental strand, 32258341 - 32258039
Alignment:
| Q |
12 |
gagatgaagcatagggaggctgtatgggataaacaagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctct--gaattataagtt |
109 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32258341 |
gagatgaagcacagggaggctgtatggggtaaactagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctctctgaattataagtt |
32258242 |
T |
|
| Q |
110 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggactcagtat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32258241 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggattcagtat |
32258142 |
T |
|
| Q |
210 |
gtatgtttaatctagtttactcgttagagattttataatctgaaatgtatttaacggtttttgtattataaaattggaaatatatatttttcccttttgc |
309 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32258141 |
gtatgtttaatctattttactcgttagagattttataatctgaaatgtatttaacggtttttgtattataaaattggaaatatatatttttcctttttgc |
32258042 |
T |
|
| Q |
310 |
tag |
312 |
Q |
| |
|
||| |
|
|
| T |
32258041 |
tag |
32258039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University