View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8198_low_16 (Length: 275)
Name: NF8198_low_16
Description: NF8198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8198_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 36527397 - 36527550
Alignment:
| Q |
1 |
ctgttttgatatgatcatgtgaagatgcgagacaatgaagtgtcatttgtattgttttcttgagccacttgaagcatggttattcttgttattggtgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527397 |
ctgttttgatatgatcatgtgaagatgccagacaatgaagtgtcatttgtattgttttcttgagccacttgaagcatggttattcttgttattggtgcga |
36527496 |
T |
 |
| Q |
101 |
attatgtactgactttgtctgtcattgactaatcaccgtcagaaaatccaattg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527497 |
attatgtactgactttgtctgtcattgactaatcaccgtcagaaaatccaattg |
36527550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 153 - 261
Target Start/End: Original strand, 36527595 - 36527703
Alignment:
| Q |
153 |
tgcgtccgttaaatggtgtcatcgactggacattccatttttgttttgctattattattgtgaaaaatgcaaagtaacacatactatttatatattttgc |
252 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36527595 |
tgcgttcgttaaatggtgtcatcgactggacattccatttttgttttgttattattattgtgaaaaatgcaaagtaacacatactatttatatattttgc |
36527694 |
T |
 |
| Q |
253 |
aatagagtg |
261 |
Q |
| |
|
||||||||| |
|
|
| T |
36527695 |
aatagagtg |
36527703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University