View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8198_low_21 (Length: 214)
Name: NF8198_low_21
Description: NF8198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8198_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 36031194 - 36031012
Alignment:
| Q |
14 |
ttattctgaatgcattattttcttgcatccatgggtgtgggaagaatgttccaaggaggtgaggttggcattctatactagtttatttgaggtattagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36031194 |
ttattctgaatgcattattttcttgcatccatggatgtgggaagaatgttccaaggaggtgaggttggcattctatactagtttatttgaggtattagga |
36031095 |
T |
 |
| Q |
114 |
atgaattaatcttgtcttaattagaaaccaactattttggaggtattggtcttattgaacatacctattggatatggtttttg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36031094 |
atgaattaatcttgtcttaattagaaaccaactattttggaggtattggtcttattgaacatacctattggatatggtttttg |
36031012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University