View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8199_high_26 (Length: 313)
Name: NF8199_high_26
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8199_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 35482134 - 35481836
Alignment:
| Q |
1 |
attgtggagaagagatatgatggtaaaggtgctcaagatctagctcgttcgataaaggatttccctagcagacgcggcgaaaagcactgggaaagttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482134 |
attgtggagaagagatatgatggtaaaggtgctcaagatctagctcgttcgataaaggatttccctagcagacgcggcgaaaagcactgggaaagttttg |
35482035 |
T |
|
| Q |
101 |
attatcatctcccaggagattgtcttgcttatttgtattacagacaaagtaaggagaataagaatccttctgatccaagaactgcttttcttcaacaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35482034 |
attatcatctcccaggagattgtcttgcttatttgtattacagacaaagtaaggagaataagaatccttctgatccaagaactgcatttcttcaacaagc |
35481935 |
T |
|
| Q |
201 |
gttgagtgctgtagagtctgataaagctagaaacgtgattttggaggagctaaatggaaaggctgaagaggaggaagttgaagatgttgtattaaaagt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35481934 |
gttgagtgctgtagagtctgataaagctagaaacgtgattttggaggagttgaatggaaaggctgaagaggagaaggttgaagatgttgtattaaaagt |
35481836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University