View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8199_high_28 (Length: 304)

Name: NF8199_high_28
Description: NF8199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8199_high_28
NF8199_high_28
[»] chr1 (1 HSPs)
chr1 (1-193)||(35482257-35482449)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 35482257 - 35482449
Alignment:
1 cacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggaggga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35482257 cacgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggaggga 35482356  T
101 agtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcaatgcgacctgggatgtcgaggttgtcgtattttgatgg 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
35482357 agtgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcgatgcgacctgggatgtcgaggttgtcgtattttgatgg 35482449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University